Journal: Journal of Cancer

Article Title: Functional Polymorphisms in BARD1 Association with Neuroblastoma in a regional Han Chinese Population

doi: 10.7150/jca.26719

Figure Lengend Snippet: (A) The BARD1 structure. The amino acid mutation caused by rs1048108, rs2229571 and rs3738888 in BARD1 were indicated. Rs1048108 (P24S) located near zinc finger ring region, which played a key role in the interaction of BARD1 and BRCA1. (B) Effect of the rs1048108 C or T allele on BARD1-BRCA1 interaction. Co-IP result showed no difference in BARD1-BRCA1 interaction between wild type and mutant type of rs1048108 C > T (P24S).

Article Snippet: To study the interaction between BARD1 and BRCA1, we obtained the human BRCA1 ORF expression plasmid (pcDNA3-HA-BRCA1) from Sino Biological lnc (Beijing, China).

Techniques: Mutagenesis, Co-Immunoprecipitation Assay

Journal: Journal of Lipid Research

Article Title: BRCA1 is a novel regulator of metabolic function in skeletal muscle

doi: 10.1194/jlr.M043851

Figure Lengend Snippet: A–F: Identification of Brca1 in male and female mouse skeletal muscle. A: Brca1 mRNA detection identified in female mouse gastrocnemius muscle (SM) with mouse testes serving as a positive control. B: Protein identification and verification of Brca1 (220 kDa) using an antibody comparison, Ab:1 (SC-I:20) Brca1 C-terminal (C-term)-specific antibody, Ab:2 (SC-D:20) Brca1 N-terminal (N-term)-specific antibody. C: Immunoprecipitation Brca1 in female mouse skeletal muscle using Ab1 and Ab2. D: Brca1 protein was greater in male compared with female mouse gastrocnemius muscle (P < 0.05). No significant differences were detected between male and female mice for Brca1Δ11 (78 kDa). Mammary gland from Brca1 KO mouse (MG KO) served as a negative control for full-length Brca1 and a positive control for the Brca1 splice variant (Brca1Δ11). E: No differences in Brca1 and Brca1Δ11 protein content in soleus, gastrocnemius (Gastroc), and TA muscles from adult female mice were detected. F: In skeletal muscle from adult male mice, no differences across muscle groups were detected in Brca1 protein content, while Brca1Δ11 content was significantly higher in the TA and soleus compared with the gastrocnemius muscle. Total protein staining gels were used to ensure equal loading of protein across samples. Data are presented as mean ± SEM (n = 3 mice per group for Western blotting measures). *P < 0.05 female versus male; #P < 0.05 TA versus gastrocnemius; $P < 0.05 TA versus soleus.

Article Snippet: Adenovirus shRNA-hBRCA1 myotube infection To reduce BRCA1 content in the human myotubes, the cells were transduced with either scrambled shRNA adenovirus (scrambled-shRNA) or adenovirus containing a shRNA sequence targeting the coding region of BRCA1 (nt.530-550_NM_007294) (shRNA-hBRCA1) and containing a RFP tag overnight (Vector Biolabs, Philadelphia, PA).

Techniques: Positive Control, Comparison, Immunoprecipitation, Negative Control, Variant Assay, Muscles, Staining, Western Blot

Journal: Journal of Lipid Research

Article Title: BRCA1 is a novel regulator of metabolic function in skeletal muscle

doi: 10.1194/jlr.M043851

Figure Lengend Snippet: A–E: An acute bout of exercise increases endogenous Acc-p and Brca1 interaction in skeletal muscle in adult male and female mice. A, B: Acc-p levels were significantly higher in response to an acute bout of exercise (Ex) in the gastrocnemius muscle from adult female and male mice compared with sedentary (Sed) mice. C: MaCoA levels were significantly higher in gastrocnemius muscles from sedentary female mice compared with sedentary male mice. Adult female mice exposed to an acute bout of exercise had significantly lower MaCoA levels compared with the female sedentary mice and no significant differences were apparent in gastrocnemius muscle from male mice. D: Interaction between Brca1 and Acc-p was greater in gastrocnemius muscle from sedentary females compared with sedentary males. Brca1 and Acc-p interaction was significantly higher after an acute bout of exercise in gastrocnemius muscles from both male and female mice when compared with their sedentary counterparts. Data are presented as mean ± SEM (n = 6–7 per group). *P < 0.05 sedentary versus exercise; #P < 0.05 male sedentary versus female sedentary; $P = 0.09 male exercise versus female exercise. E: Changes in Brca1 mRNA in the plantaris muscle in age-matched C57Bl/6 female mice after 12 weeks of a NCD or a HFD. Data are presented as mean ± SEM (n = 4 per group). *P < 0.05 NCD versus HFD. IB, immunoblot; IP, immunoprecipitation.

Article Snippet: Adenovirus shRNA-hBRCA1 myotube infection To reduce BRCA1 content in the human myotubes, the cells were transduced with either scrambled shRNA adenovirus (scrambled-shRNA) or adenovirus containing a shRNA sequence targeting the coding region of BRCA1 (nt.530-550_NM_007294) (shRNA-hBRCA1) and containing a RFP tag overnight (Vector Biolabs, Philadelphia, PA).

Techniques: Muscles, Western Blot, Immunoprecipitation

Journal: Journal of Lipid Research

Article Title: BRCA1 is a novel regulator of metabolic function in skeletal muscle

doi: 10.1194/jlr.M043851

Figure Lengend Snippet: A–F: BRCA1 expression is detectable in biopsies taken from human VL. A–C: No significant differences were detected in mRNA expression of all recognized human BRCA1 variants in skeletal muscle biopsies taken from males and females. All data were normalized to GAPDH. D: The presence of BRCA1 protein in human skeletal muscle was verified using antibodies specific to the C terminus (C-term) (Ab:1) or N terminus (N-term) (Ab:2). E: No significant differences in BRCA1 protein were detected between men and women in biopsies from the VL. F: Full length BRCA1 was detected predominantly in the nuclear fraction isolated from the VL from men and women, whereas the BRCA1Δ11/Δ11 splice variant was detected in the cytoplasmic fraction. Cell lysates isolated from the mammary gland of BRCA1 KO animals were used as a positive control for the BRCA1Δ11/Δ11b splice variants. Laminin was used as a nuclear control protein and β-tubulin as the cytoplasmic control protein. Data are presented as mean ± SEM (n = 13 per group for mRNA analysis; n = 5–6 per group for BRCA1 Western blot analysis).

Article Snippet: Adenovirus shRNA-hBRCA1 myotube infection To reduce BRCA1 content in the human myotubes, the cells were transduced with either scrambled shRNA adenovirus (scrambled-shRNA) or adenovirus containing a shRNA sequence targeting the coding region of BRCA1 (nt.530-550_NM_007294) (shRNA-hBRCA1) and containing a RFP tag overnight (Vector Biolabs, Philadelphia, PA).

Techniques: Expressing, Isolation, Variant Assay, Positive Control, Control, Western Blot

Journal: Journal of Lipid Research

Article Title: BRCA1 is a novel regulator of metabolic function in skeletal muscle

doi: 10.1194/jlr.M043851

Figure Lengend Snippet: A–E: An acute bout of exercise in men and women resulted in a greater interaction between ACC-p and BRCA1 in muscle biopsies taken from the VL. A: Significant increases were found in ACC-p content compared with pre-exercise (pre) in both male and female subjects. B: Representative results from the ACC immunoblot generated from the human muscle biopsies. C: In response to an acute bout of exercise in men and women, the majority of subjects had increased BRCA1-ACC-p interaction compared with pre-exercise. Each line represents an individual subject and is marked with the sex and magnitude of response. D: Group average of BRCA1-ACC-p interaction in response to the acute bout of exercise. Data from male and female subjects were collapsed. E: Representative immunoprecipitation-immunoblot of the ACC-p-BRCA1 complex in response to the acute exercise. Data are presented as mean ± SEM (n = 5–6 per group for BRCA1 Western blot analysis). *P ≤ 0.05 sedentary versus exercise within female or male subjects.

Article Snippet: Adenovirus shRNA-hBRCA1 myotube infection To reduce BRCA1 content in the human myotubes, the cells were transduced with either scrambled shRNA adenovirus (scrambled-shRNA) or adenovirus containing a shRNA sequence targeting the coding region of BRCA1 (nt.530-550_NM_007294) (shRNA-hBRCA1) and containing a RFP tag overnight (Vector Biolabs, Philadelphia, PA).

Techniques: Western Blot, Generated, Immunoprecipitation

Journal: Journal of Lipid Research

Article Title: BRCA1 is a novel regulator of metabolic function in skeletal muscle

doi: 10.1194/jlr.M043851

Figure Lengend Snippet: A–D: Reduction in BRCA1 enhances neutral lipid storage and decreases insulin-induced glucose uptake in primary human myotubes. A: Human myotubes transduced with shRNA for human BRCA1 (shRNA-hBRCA1) presented with reduced BRCA1 total, BRCA1Δ11, and BRCA1Δ11b compared with cells infected with scrambled-shRNA. B: Myotubes with reduced BRCA1 expression exposed to either BSA or 30 μM palmitate/oleate-conjugated BSA exhibited increased neutral lipid accumulation in myotubes compared with myotubes infected with scrambled-shRNA. C: Insulin-induced phosphorylation of Akt was reduced in myotubes with reduced BRCA1 expression compared with control myotubes. Myotubes were treated with 50 nM insulin for 30 min. D: Insulin-induced glucose uptake was reduced in myotubes with reduced BRCA1 expression compared with control myotubes. Insulin-induced uptake values are normalized to basal glucose uptake values. No differences in basal uptake were detected between groups. Data are presented as mean ± SEM (n = 3–5 per group for all analyses). *P < 0.05 scrambled-shRNA versus shRNA-hBRCA1 myotubes.

Article Snippet: Adenovirus shRNA-hBRCA1 myotube infection To reduce BRCA1 content in the human myotubes, the cells were transduced with either scrambled shRNA adenovirus (scrambled-shRNA) or adenovirus containing a shRNA sequence targeting the coding region of BRCA1 (nt.530-550_NM_007294) (shRNA-hBRCA1) and containing a RFP tag overnight (Vector Biolabs, Philadelphia, PA).

Techniques: Transduction, shRNA, Infection, Expressing, Phospho-proteomics, Control

Journal: Journal of Lipid Research

Article Title: BRCA1 is a novel regulator of metabolic function in skeletal muscle

doi: 10.1194/jlr.M043851

Figure Lengend Snippet: A–E: Reduction in human myotube BRCA1 content decreases mitochondrial oxygen consumption. A: A representative respiration experiment in human myotubes transduced with scrambled-shRNA (Scramb-shRNA) (black line) or shRNA specific to human BRCA1 (gray line). These data are shown to provide a reader with a visual example of how the respiration experiments were conducted. B: Basal OCR was reduced in shRNA-hBRCA1 human myotubes compared with scrambled-shRNA myotubes. C: Uncoupling the mitochondria with FCCP (400 nM) resulted in a reduced OCR in shRNA-hBRCA1 myotubes compared with scrambled-shRNA. D: Palmitate (PA) (100 μM) stimulated OCR was significantly reduced in shRNA-hBRCA1 myotubes compared with scrambled-shRNA myotubes. E: No difference in the mitochondrial protein ATP 5A was detected in scrambled-shRNA and shRNA-hBRCA1 myotubes. Equal loading was confirmed through RFP measures. Data are presented as mean ± SEM (n = 3–5 per group for all analyses). *P < 0.05 scrambled-shRNA versus shRNA-hBRCA1 myotubes.

Article Snippet: Adenovirus shRNA-hBRCA1 myotube infection To reduce BRCA1 content in the human myotubes, the cells were transduced with either scrambled shRNA adenovirus (scrambled-shRNA) or adenovirus containing a shRNA sequence targeting the coding region of BRCA1 (nt.530-550_NM_007294) (shRNA-hBRCA1) and containing a RFP tag overnight (Vector Biolabs, Philadelphia, PA).

Techniques: Transduction, shRNA

Journal: Journal of Lipid Research

Article Title: BRCA1 is a novel regulator of metabolic function in skeletal muscle

doi: 10.1194/jlr.M043851

Figure Lengend Snippet: A, B: Reduced BRCA1 expression results in increased basal phosphorylation of ACC and failure of AICAR to induce further phosphorylation of ACC. A, B: ACC-p response was attenuated in AICAR-treated shRNA-hBRCA1 compared with scrambled-shRNA. Data are presented as mean ± SEM (n = 3–5 per group for all analyses). *P < 0.05 scrambled-shRNA versus shRNA-hBRCA1 myotubes.

Article Snippet: Adenovirus shRNA-hBRCA1 myotube infection To reduce BRCA1 content in the human myotubes, the cells were transduced with either scrambled shRNA adenovirus (scrambled-shRNA) or adenovirus containing a shRNA sequence targeting the coding region of BRCA1 (nt.530-550_NM_007294) (shRNA-hBRCA1) and containing a RFP tag overnight (Vector Biolabs, Philadelphia, PA).

Techniques: Expressing, Phospho-proteomics, shRNA

Journal: Journal of Lipid Research

Article Title: BRCA1 is a novel regulator of metabolic function in skeletal muscle

doi: 10.1194/jlr.M043851

Figure Lengend Snippet: A–G: Reduced BRCA1 expression in primary human myotubes increases ROS accumulation. A–F: Human myotubes transduced with shRNA-BRCA1 exhibit visual increases in ROS signal (green signal marked with white arrows) compared with cells infected with scrambled-shRNA (Scramb-shRNA). Both shRNA-BRCA1 and scrambled-shRNA plasmids contained a RFP tag to ensure appropriate transfection (red signal). A, D: Human myotubes infected with scrambled-shRNA exhibit little to no DCF signal. B, E: Human myotubes infected with shRNA-BRCA1 exhibit localized DCF signal at 10× magnification. C, F: Higher magnification (20×) imaging demonstrates that human myotubes infected with shRNA-BRCA1 exhibit DCF signal localized to unknown vacuoles. G: Quantification of basal ROS accumulation in human myotubes with shRNA-BRCA1 compared with myotubes infected with scrambled-shRNA. Data are presented as mean ± SEM (n = 3–5 per group for all analyses). *P < 0.05 scrambled-shRNA versus shRNA-hBRCA1 myotubes.

Article Snippet: Adenovirus shRNA-hBRCA1 myotube infection To reduce BRCA1 content in the human myotubes, the cells were transduced with either scrambled shRNA adenovirus (scrambled-shRNA) or adenovirus containing a shRNA sequence targeting the coding region of BRCA1 (nt.530-550_NM_007294) (shRNA-hBRCA1) and containing a RFP tag overnight (Vector Biolabs, Philadelphia, PA).

Techniques: Expressing, Transduction, shRNA, Infection, Transfection, Imaging

Journal: The Journal of thoracic and cardiovascular surgery

Article Title: BRCA1 shields vascular smooth muscle cells from oxidative stress.

doi: 10.1016/j.jtcvs.2013.09.060

Figure Lengend Snippet: FIGURE 1. BRCA1 is constitutively expressed in aortic SMCs. A, Representative agarose gel image and (B) immunoblot confirming the constitutive presenceofBRCA1transcriptandproteininC57Bl/6JMASMCs, WKY RASMCs and HASMCs. n ¼ 5 per group. SMC, Smooth muscle cells; BRCA1, breast cancer 1, early onset gene; MW, molecular weight marker; GAPDH, glyceraldehyde-3-phosphate dehydrogenase.

Article Snippet: The custom-designed BRCA1 adenovirus (Ad-BRCA1; containing the complete coding sequence of human BRCA1 [accession no. NM_007294.2]) and the control adenovirus Ad-null were from Vector BioLabs (Philadelphia, Penn).

Techniques: Agarose Gel Electrophoresis, Western Blot, Molecular Weight, Marker

Journal: The Journal of thoracic and cardiovascular surgery

Article Title: BRCA1 shields vascular smooth muscle cells from oxidative stress.

doi: 10.1016/j.jtcvs.2013.09.060

Figure Lengend Snippet: FIGURE 2. BRCA1 overexpression reduces oxidative stress in HASMCs via the NADPH oxidase system. ROS production was determined by (A) CM-DCF and (B) DHE fluorescence in HASMCs stressed for 24 hours with H2O2. Representative Western blots and semiquantitative data for the NADPH oxidase subunits (C) Nox1 and (D). p47phox in naive and adenovirus-treated HASMCs. GAPDH acted as the housekeeping protein. n ¼ 5 per group. *P <.05 versus the corresponding untreated group; yP <.05 versus the H2O2-treated Ad-null–transfected group. CM-DCF, 6-Chloromethyl- 20,70-dichlorodihydrofluorescein diacetate, acetyl ester; Ad-null, control adenovirus; Ad-BRCA1, BRCA1 adenovirus; DHE, dihydroethidium; GAPDH, glyceraldehyde-3-phosphate dehydrogenase.

Article Snippet: The custom-designed BRCA1 adenovirus (Ad-BRCA1; containing the complete coding sequence of human BRCA1 [accession no. NM_007294.2]) and the control adenovirus Ad-null were from Vector BioLabs (Philadelphia, Penn).

Techniques: Over Expression, Western Blot, Transfection, Control

Journal: The Journal of thoracic and cardiovascular surgery

Article Title: BRCA1 shields vascular smooth muscle cells from oxidative stress.

doi: 10.1016/j.jtcvs.2013.09.060

Figure Lengend Snippet: FIGURE 3. Aortas and RASMCs from SHR rats express less BRCA1 than those from WKY rats. BRCA1 transcripts in (A) WKY and SHR rat aorta and (B) RASMC homogenates were assessed via qPCR. n ¼ 5 per group. *P<.05 versus WKY group. BRCA1, Breast cancer 1, early onset gene; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; WKY, Wistar- Kyoto rat; SHR, spontaneously hypertensive rat; RASMC, rat aortic smooth muscle cells.

Article Snippet: The custom-designed BRCA1 adenovirus (Ad-BRCA1; containing the complete coding sequence of human BRCA1 [accession no. NM_007294.2]) and the control adenovirus Ad-null were from Vector BioLabs (Philadelphia, Penn).

Techniques:

Journal: The Journal of thoracic and cardiovascular surgery

Article Title: BRCA1 shields vascular smooth muscle cells from oxidative stress.

doi: 10.1016/j.jtcvs.2013.09.060

Figure Lengend Snippet: FIGURE 4. BRCA1 overexpression reduces oxidative stress in SHR RASMCs via the NADPH oxidase system. A, ROS production and (B) NADPH oxidase activity were assessed by CM-DCF fluorescence and lucigenin-enhanced chemiluminescence, respectively, in homogenates of WKY RASMCs and adenovirus- transfectedSHRRASMCs(n¼ 6pergroup).Representative WesternblotsandsemiquantitativedatafortheNADPHoxidasesubunits(C)Nox1and(D)p47phox in WKYand SHR RASMC homogenates. n ¼ 5 per group. *P<.05 versus WKY group; yP<.05 versus Ad-null SHR group. CM-DCF, 6-Chloromethyl-20,70- dichlorodihydrofluorescein diacetate, acetyl ester; WKY, Wistar-Kyoto rat; Ad-null, control adenovirus; Ad-BRCA1, BRCA1 adenovirus; SHR, spontaneously hypertensive rat; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; NADPH, nicotinamide adenine dinucleotide phosphate.

Article Snippet: The custom-designed BRCA1 adenovirus (Ad-BRCA1; containing the complete coding sequence of human BRCA1 [accession no. NM_007294.2]) and the control adenovirus Ad-null were from Vector BioLabs (Philadelphia, Penn).

Techniques: Over Expression, Activity Assay, Control

Journal: The Journal of thoracic and cardiovascular surgery

Article Title: BRCA1 shields vascular smooth muscle cells from oxidative stress.

doi: 10.1016/j.jtcvs.2013.09.060

Figure Lengend Snippet: FIGURE 5. BRCA1 overexpression lowers systolic and diastolic blood pressure in SHR rats. A, Blood pressure and (B) heart rates were continuously recorded via radiotelemetry in SHR rats treated with either Ad-null or Ad-BRCA1 (5 3 1010 IU/rat, intravenously). n ¼ 9 per group. *P < .05 versus Ad-null. Ad-null, Control adenovirus; Ad-BRCA1, BRCA1 adenovirus.

Article Snippet: The custom-designed BRCA1 adenovirus (Ad-BRCA1; containing the complete coding sequence of human BRCA1 [accession no. NM_007294.2]) and the control adenovirus Ad-null were from Vector BioLabs (Philadelphia, Penn).

Techniques: Over Expression, Control

Journal: The Journal of thoracic and cardiovascular surgery

Article Title: BRCA1 shields vascular smooth muscle cells from oxidative stress.

doi: 10.1016/j.jtcvs.2013.09.060

Figure Lengend Snippet: FIGURE 6. BRCA1 overexpression reduces aortic oxidative stress in SHR rats via the NADPH oxidase system. A, ROS production (n ¼ 10 per group) and (B) NADPH oxidase activity (n ¼ 6 pergroup) in aorta homogenatesfrom WKYand adenovirus-treated SHR rats were assessed by lucigenin-enhanced chem- iluminescence. C, Representative Western blots and semiquantitative data for the NADPH oxidase subunits Nox1 and p47phox in WKY and adenovirus- treated SHR rat aortas. GAPDH acted as the housekeeping protein. n ¼ 6 per group. *P<.05 versus WKY group; yP<.05 versus Ad-null SHR group. ROS, Reactive oxygen species; WKY, Wistar-Kyoto rat; Ad-null, control adenovirus; Ad-BRCA1, BRCA1 adenovirus; SHR, spontaneously hypertensive rat; RLU, relative light units; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; NADPH, nicotinamide adenine dinucleotide phosphate.

Article Snippet: The custom-designed BRCA1 adenovirus (Ad-BRCA1; containing the complete coding sequence of human BRCA1 [accession no. NM_007294.2]) and the control adenovirus Ad-null were from Vector BioLabs (Philadelphia, Penn).

Techniques: Over Expression, Activity Assay, Western Blot, Control

Journal: The Journal of thoracic and cardiovascular surgery

Article Title: BRCA1 shields vascular smooth muscle cells from oxidative stress.

doi: 10.1016/j.jtcvs.2013.09.060

Figure Lengend Snippet: FIGURE 7. Aortas from Ad-BRCA1–treated SHR rats exhibit less H2A.X phosphorylation than those from Ad-null–treated SHR rats. gH2A.X levels were assessed via immunohistochemistry. Images are representative of n ¼ 5 per group. *P <.05 versus WKY group; yP <.05 versus Ad-null SHR group. WKY, Wistar-Kyoto rat; SHR, spontaneously hypertensive rat; Ad-null, control adenovirus; Ad-BRCA1, BRCA1 adenovirus.

Article Snippet: The custom-designed BRCA1 adenovirus (Ad-BRCA1; containing the complete coding sequence of human BRCA1 [accession no. NM_007294.2]) and the control adenovirus Ad-null were from Vector BioLabs (Philadelphia, Penn).

Techniques: Phospho-proteomics, Immunohistochemistry, Control

Journal: The Journal of thoracic and cardiovascular surgery

Article Title: BRCA1 shields vascular smooth muscle cells from oxidative stress.

doi: 10.1016/j.jtcvs.2013.09.060

Figure Lengend Snippet: FIGURE 8. Aortas from Ad-BRCA1–treated SHR rats exhibit more RAD51 foci formation than those from Ad-null–treated SHR rats. RAD51 foci were quantified via immunohistochemistry. Images are representative of n ¼ 5 per group. *P<.05 versus WKY group; yP<.05 versus Ad-null SHR group. WKY, Wistar-Kyoto rat; SHR, spontaneously hypertensive rat; Ad-null, control adenovirus; Ad-BRCA1, BRCA1 adenovirus.

Article Snippet: The custom-designed BRCA1 adenovirus (Ad-BRCA1; containing the complete coding sequence of human BRCA1 [accession no. NM_007294.2]) and the control adenovirus Ad-null were from Vector BioLabs (Philadelphia, Penn).

Techniques: Immunohistochemistry, Control

Journal: Cancer Cell International

Article Title: Transactivation of the estrogen receptor promoter by BRCA1

doi: 10.1186/s12935-017-0401-2

Figure Lengend Snippet: Transcriptional activation of the ER promoter by BRCA1. Promoter activity for a series of ER promoter constructs with progressive 5′ deletions designed to sequentially remove the established regulatory sites. Fold induction in luciferase activity ( x axis ) is shown for each of the ER promoter constructs following transfection with either a BRCA1 expression plasmid ( filled bars ) or the empty pRK7 vector ( open bars ). The fold induction in luciferase activity is the number of photon units per unit time of data capture (RLU) divided by protein, normalized by the corresponding value from cells transfected with the empty pGL2 Basic vector. RLU/protein values from the empty pGL2 Basic vector ranged from ~35 to ~400, while those from the ER promoter constructs were >1500. Data shown represents the average of up to 7 experiments, with luciferase and protein measurements performed in triplicate for each experiment

Article Snippet: Luciferase experiments involved cotransfection of cells with either a BRCA1 expression plasmid or empty vector (pRK7, Genentech, S. San Francisco, CA), along with one of the ER promoter constructs.

Techniques: Activation Assay, Activity Assay, Construct, Luciferase, Transfection, Expressing, Plasmid Preparation

Journal: Cancer Cell International

Article Title: Transactivation of the estrogen receptor promoter by BRCA1

doi: 10.1186/s12935-017-0401-2

Figure Lengend Snippet: Transcriptional activation by BRCA1 with a series of Exo III-generated ER promoter luciferase constructs. Luciferase activity for Exo III-generated ER promoter constructs in MCF10A cells. Fold induction in luciferase activity ( x axis ) is shown for ER promoter constructs following co-transfection with either a BRCA1 expression plasmid ( filled bars ) or the empty pRK7 vector ( open bars ). Fold induction values were calculated as in Fig. . Data shown represents the average of 2–7 experiments, with luciferase and protein measurements performed in triplicate for each experiment

Article Snippet: Luciferase experiments involved cotransfection of cells with either a BRCA1 expression plasmid or empty vector (pRK7, Genentech, S. San Francisco, CA), along with one of the ER promoter constructs.

Techniques: Activation Assay, Generated, Luciferase, Construct, Activity Assay, Cotransfection, Expressing, Plasmid Preparation

Journal: Cancer Cell International

Article Title: Transactivation of the estrogen receptor promoter by BRCA1

doi: 10.1186/s12935-017-0401-2

Figure Lengend Snippet: Localization of the segment of ER promoter mediating transactivation by BRCA1. Mean fold induction in luciferase activity ( y axis ) by BRCA1 in MCF10A cells ( top panel ) and IMEC cells ( bottom panel ) is indicated for all ER promoter constructs ( x axis ), calculated as the ratio of promoter activity when co-transfected with BRCA1, divided by promoter activity measured with co-transfection of pRK7. Standard error of the mean is indicated

Article Snippet: Luciferase experiments involved cotransfection of cells with either a BRCA1 expression plasmid or empty vector (pRK7, Genentech, S. San Francisco, CA), along with one of the ER promoter constructs.

Techniques: Luciferase, Activity Assay, Construct, Transfection, Cotransfection

Journal: Cancer Cell International

Article Title: Transactivation of the estrogen receptor promoter by BRCA1

doi: 10.1186/s12935-017-0401-2

Figure Lengend Snippet: Expression of ER mRNA following transfection with BRCA1 or pRK7. Cells were harvested 48 h after transfection and mRNA for RT-PCR analysis were prepared. PCR products from the RT-PCR analysis were run on an agarose gel for analysis of ER mRNA, with the products appearing at the expected size of 603 bp ( arrow ). Reverse transcriptase (RT) reactions were performed with or without RT to control for contamination, and mRNA prepared from untransfected MCF7 cells serving as positive control

Article Snippet: Luciferase experiments involved cotransfection of cells with either a BRCA1 expression plasmid or empty vector (pRK7, Genentech, S. San Francisco, CA), along with one of the ER promoter constructs.

Techniques: Expressing, Transfection, Reverse Transcription Polymerase Chain Reaction, Agarose Gel Electrophoresis, Reverse Transcription, Control, Positive Control

Journal: Journal of Cellular and Molecular Medicine

Article Title: EBV–encoded miRNAs can sensitize nasopharyngeal carcinoma to chemotherapeutic drugs by targeting BRCA1

doi: 10.1111/jcmm.16007

Figure Lengend Snippet: Down‐regulation of BRCA1 in EBV‐associated NPCs. (A) The expression of BRCA1, ATM and PARP1 proteins in immortalized normal NP (NP69), four NPC cell lines and four NPC patient‐derived xenografts (PDXs) were analysed by immunoblotting. Actin was probed as the loading control. (B) The expression levels of BRCA1 mRNA in the cell lines were measured using RT‐qPCR. The relative BRCA1 mRNA expression was calculated using 2(∆∆−Ct) method, and the expression in NP69 was set as 1 for comparison. The data shown is the mean + SD. (C) The whiskers 10‐90 percentiles plot shows the relative BRCA1 mRNA expression in primary samples. The BRCA1 mRNA was significantly up‐regulated in NPCs (n = 55) when compared with the NPs (n = 22). (D) Immunohistochemistry staining of BRCA1 protein in primary samples (number of NPs = 30 and NPCs = 41). The representative images of negative and positive BRCA1 stain in NP and NPC specimens are shown (original magnification X400). (E) The dot plot shows the total expression levels of miR‐BART2‐3p, BART12, BART17‐5p and BART19‐3p in 20 NPC biopsies, in which the BRCA1 protein expression status was analysed in IHC. The expression of miR‐BARTs was normalized to EBNA1. The median values of each group are shown by the dash line and the Mann‐Whitney test was used for the statistical analysis

Article Snippet: The BRCA1 expression vector, pMH‐SFB‐BRCA1, was obtained from Addgene (plasmid #99394).

Techniques: Expressing, Derivative Assay, Western Blot, Control, Quantitative RT-PCR, Comparison, Immunohistochemistry, Staining, MANN-WHITNEY

Journal: Journal of Cellular and Molecular Medicine

Article Title: EBV–encoded miRNAs can sensitize nasopharyngeal carcinoma to chemotherapeutic drugs by targeting BRCA1

doi: 10.1111/jcmm.16007

Figure Lengend Snippet: The BRCA1 is the potential target of miR‐BARTs. (A) The relative luciferase activity of the reporter plasmids harbouring a full length of BRCA1‐3’UTR (sFL‐3’UTR) or a full length of BRCA1‐3’UTR in reversed orientation (asFL‐3’UTR) was co‐transfected together with the indicated miRNAs. The luciferase signal with the co‐transfection of negative miRNA mimic control (miR‐NEG) was set at 1 for comparison. (B) The direct interaction between the putative binding sites on BRCA1 and miR‐BARTs were demonstrated in the reporter assays. The firefly luciferase reporter activity was normalized to the Renilla luciferase control. The data shown is the mean + SD from three independent experiments. The result with the co‐transfection of miR‐NEG and pMIR‐CTL was set at 1. pMIR‐CTL = pMIR‐REPORTTM vectors containing unrelated sequences; pMIR‐B = pMIR‐REPORTTM vector harbouring the predicted miR‐BART binding site, pMIR‐CDS = predicted binding site on CDS (Table ). B2‐3p = BART2‐3p; B12 = BART12; B17‐5p = BART17‐5p; B19‐3p = BART19‐3p. * P < 0.05, ** P < 0.001

Article Snippet: The BRCA1 expression vector, pMH‐SFB‐BRCA1, was obtained from Addgene (plasmid #99394).

Techniques: Luciferase, Activity Assay, Transfection, Cotransfection, Control, Comparison, Binding Assay, Plasmid Preparation

Journal: Journal of Cellular and Molecular Medicine

Article Title: EBV–encoded miRNAs can sensitize nasopharyngeal carcinoma to chemotherapeutic drugs by targeting BRCA1

doi: 10.1111/jcmm.16007

Figure Lengend Snippet: Regulation of BRCA1 expression by miR‐BARTs (A) Western blot of BRCA1 in NPC cell lines. Actin was probed as the protein‐loading control, and the expression level was compared with NP69 (set as 1). (B) The total expression of viral BART2‐3p, BART12, BART17‐5p and BART19‐3p (upper panel) and the expression of cellular miR‐146a (lower panel) in the cell lines were assayed by RT‐qPCR. The expression values of total miR‐BARTs and miR‐146a were calculated using the 2(‐∆Ct) and 2(∆∆‐Ct) methods, respectively. The analysis of each sample was performed in triplicate with mean + SD shown. (C) In the EBV‐negative epithelial cells, the BRCA1 level was suppressed by the transfection of the indicated miRNA mimics, BART2‐3p (B2‐3p), BART12 (BT12), BART17‐5p (BT17‐5p) and BART19‐3p (BT19‐3p). (D) The BRCA1 protein expression in C666‐1 cells was regained by suppressing the endogenous miR‐BARTs activities with specific miR‐BART inhibitors for 48 h. The negative control mimic/inhibitor (Inh‐Ctl) transfection was used for comparison. Either actin or vinculin was probed as the loading control

Article Snippet: The BRCA1 expression vector, pMH‐SFB‐BRCA1, was obtained from Addgene (plasmid #99394).

Techniques: Expressing, Western Blot, Control, Quantitative RT-PCR, Transfection, Negative Control, Comparison

Journal: Journal of Cellular and Molecular Medicine

Article Title: EBV–encoded miRNAs can sensitize nasopharyngeal carcinoma to chemotherapeutic drugs by targeting BRCA1

doi: 10.1111/jcmm.16007

Figure Lengend Snippet: The CDDP and DOX sensitivity in HK1 and NP69 cells. (A) Western blot of p53 and p21 in NPC cell lines were analysed. (B) Transfection of either BRCA1‐specific siRNA, BART17‐5p or BART19‐3p mimics increased CDDP‐ and DOX‐mediated S phase or G2/M phase cell‐cycle arrest in the HK1 and NP69 cells. The transfected cells were incubated with either the control buffer or the indicated chemotherapeutic agent for 24 h. Subsequently, the cells were fixed for DNA content analysis with BD FACSCalibur flow cytometry system. (C) Protein lysate from the treated cells were harvested for phosphor‐CHK1 (p‐CHK1) expression analysis. (D) The suppression of BRCA1 sensitized HK1 cells to CDDP and DOX treatment. HK1 cells were transfected with BRCA1‐specific siRNAs (si‐BRCA1) or siRNA control (si‐NEG) and the protein lysates were collected for BRCA1 expression analysis 24 h after transfection (left panel). The transfected HK1 cells were incubated with different concentrations of CDDP or DOX for 48 h before CCK‐8 analysis. The IC50 value was determined by fitting a sigmoidal dose‐response curve to the data using GraphPad Prism 5 program. Sum‐of‐squares F‐test was used as the comparison method (right panel). (E) Clonogenic survival assays. Approximately 500 or 1000 transfected cells were seeded into the 6‐well plate and treated with CDDP or DOX for 24 h. The cells were cultured for 14‐18 d in normal medium before staining, and colonies containing more than 30 cells were counted. The number of colonies generated from the mock treatment was compared (set as 100%). All the experiments were performed in triplicate and the Student's t ‐test was conducted, compared with the control transfected cells. * P < 0.05; ** P < 0.01

Article Snippet: The BRCA1 expression vector, pMH‐SFB‐BRCA1, was obtained from Addgene (plasmid #99394).

Techniques: Western Blot, Transfection, Incubation, Control, Flow Cytometry, Expressing, CCK-8 Assay, Comparison, Cell Culture, Staining, Generated

Journal: Journal of Cellular and Molecular Medicine

Article Title: EBV–encoded miRNAs can sensitize nasopharyngeal carcinoma to chemotherapeutic drugs by targeting BRCA1

doi: 10.1111/jcmm.16007

Figure Lengend Snippet: The EBV‐miRNAs impair cisplatin‐ and doxorubicin‐induced DNA damage response in nasopharyngeal epithelial cells. The representative images of the RAD51 foci staining in HK1 cells (upper left panel) and NP69 cells (upper right panel) are shown. The cells transfected with either siRNA control (si‐NEG), BRCA1‐specific siRNA (si‐BRCA1) or miR‐BARTs mimics were treated with cisplatin (CDDP) and doxorubicin (DOX), followed by immunostaining with the RAD51 antibody. At least 100 nuclei were randomly selected for counting, and the cells containing more than five apparent RAD51 foci in the nucleus were considered positive. The percentage of the RAD51‐positive cells with mean + SD from three independent experiments are shown in the lower panel. Student's t ‐test was used to compare them with the control transfected cells (miR‐NEG) in each set of experiments. * P < 0.05; ** P < 0.01; *** P < 0.001

Article Snippet: The BRCA1 expression vector, pMH‐SFB‐BRCA1, was obtained from Addgene (plasmid #99394).

Techniques: Staining, Transfection, Control, Immunostaining

Journal: Journal of Experimental & Clinical Cancer Research : CR

Article Title: A first-in-class inhibitor of homologous recombination DNA repair counteracts tumour growth, metastasis and therapeutic resistance in pancreatic cancer

doi: 10.1186/s13046-025-03389-5

Figure Lengend Snippet: BBIT20 inhibits the BRCA1-BARD1 interaction, in PDAC and yeast cells. ( A - C ) Disruption of the BRCA1-BARD1 interaction by 12 and 18 µM of BBIT20, after (A) 8 h (in PANC-1 cells) and ( B ) 4 h (in MIA-PaCa-2 cells), evaluated by co-immunoprecipitation. In ( A , B ), representative immunoblots are shown, with whole-cell lysates represented as inputs. GAPDH was used as a loading control for inputs. In ( C ), quantification of BARD1 protein levels co-immunoprecipitated with BRCA1, using BRCA1 from the co-immunoprecipitation as a loading control; values with DMSO were set as 1; data are mean ± SEM of four independent experiments; values significantly different from DMSO: **** p < 0.0001 (two-way ANOVA with Dunnett’s test). In ( D , E ), nuclear-cytoplasmic translocation of BRCA1, after 48 h of treatment with 6 µM of BBIT20, analysed by immunofluorescence. In ( D ), representative images (scale bar = 50 μm; 400× magnification) of BRCA1 staining (green) with nuclear counterstaining (DAPI, blue) are shown. In ( E ), quantification of BRCA1 nuclear and cytoplasmic foci formation, represented as mean ± SEM of four independent experiments (100 cells per sample); values significantly different from DMSO: **** p < 0.0001 (two-way ANOVA with Sidak’s test). In ( F , G ), yeast two-hybrid assay showing the effect of 10 and 20 µM of BBIT20 on disrupting the BRCA1-BARD1 interaction, evaluated by measuring the growth of diploid yeast strain co-expressing BRCA1 and BARD1 on SD/-Leu/-Trp/-His/-Ade/X-alpha-Gal plates. In ( F ), effect of 10 and 20 µM of BBIT20 on disrupting the BRCA1-BARD1 interaction, but not murine p53-SV40 large T-antigen interaction (control), in diploid yeast strains. Representative images are shown, colony growth was assessed after 2 days of incubation at 30 ºC. In ( G ), quantification of colony-forming units per liter (CFUs/L) of a diploid yeast strain co-expressing BRCA1 and BARD1 treated with 10 and 20 µM of BBIT20, after 2 days of incubation at 30 ºC; data are mean ± SEM of four independent experiments; values significantly different from DMSO: ** p < 0.01, **** p < 0.0001 (one-way ANOVA with Dunnett’s test)

Article Snippet: The full-length BARD1 gene was amplified by PCR from the plasmid pY3H-AdeI-BARD1 (kind gift from Joanna R. Morris [ ]) using the primers Fw_Y2H_BARD1_SmaI (5’ TCCCCCGGGTATGCCGGATAATCGGCAGC) and Rv_BARD1_Notl (5’ ATAAGAATGCGGCCGCATCAGCTGTCAAGAGGAAGC) and cloned into the Sma I- Not I sites of the pGBKT7 bait vector (Takara Bio, Enzifarma, Porto, Portugal). pGADT7 AD-BRCA1, empty pGADT7 AD and pGADT7-T were transformed into Saccharomyces cerevisiae Y187 (Takara Bio, Enzifarma, Porto, Portugal) and selected in SD/-Leu plates. pGBKT7-BARD1 and pGBKT7-53 were transformed into S. cerevisiae Y2H Gold (Takara Bio, Enzifarma, Porto, Portugal) and selected in SD/-Leu plates.

Techniques: Disruption, Immunoprecipitation, Western Blot, Control, Translocation Assay, Immunofluorescence, Staining, Y2H Assay, Expressing, Incubation

Journal: Journal of Experimental & Clinical Cancer Research : CR

Article Title: A first-in-class inhibitor of homologous recombination DNA repair counteracts tumour growth, metastasis and therapeutic resistance in pancreatic cancer

doi: 10.1186/s13046-025-03389-5

Figure Lengend Snippet: BBIT20 inhibits HR and NHEJ DSBs repair pathways, inducing DNA damage, in PDAC cells. In ( A ), protein levels of BRCA1, BRCA2, RAD50, RAD51, RAD52, RAD54, BARD1 and γH2AX, in PANC-1 and MIA-PaCa-2 cells, after 48 h of treatment with 3 and 6 µM of BBIT20; representative immunoblots of four independent experiments are shown; GAPDH or vinculin were used as loading controls. In ( B ), immunofluorescence of RAD51 and γH2AX foci formation after 48 h of treatment with 6 µM of BBIT20; representative images are shown (scale bar = 50 μm, 400× magnification). In ( C , D ), quantification of ( C ) RAD51 and ( D ) γH2AX nuclear foci, in PANC-1 and MIA-PaCa-2 cells. Data are mean ± SEM of four independent experiments (200 cells per sample). Quantification of the number of foci/cell significantly different from DMSO: ** p < 0.01, *** p < 0.001, **** p < 0.0001 (two-way ANOVA with Sidak’s test). In ( E - G ), evaluation of DNA damage in PANC-1 and MIA-PaCa-2 cells, after 48 h of treatment with 6 µM of BBIT20, by COMET assay. In ( E ), representative images are shown (scale bar = 100 μm, 200× magnification). In ( F , G ), quantification of ( F ) tail DNA percentage and ( G ) tail moment; data are mean ± SEM of four independent experiments (200 cells per sample); values significantly different from DMSO: * p < 0.05, **** p < 0.0001 (two-way ANOVA with Dunnett’s test). In ( H ), NHEJ efficiency in PANC-1 treated with DMSO, 12 and 18 µM of BBIT20. Data are mean ± SEM of three independent experiments. NHEJ efficiency was calculated as the ratio of GFP-positive to mCherry-positive cells. Values significantly different from DMSO: * p < 0.05, ** p < 0.01 (one-way ANOVA with Dunnett’s test)

Article Snippet: The full-length BARD1 gene was amplified by PCR from the plasmid pY3H-AdeI-BARD1 (kind gift from Joanna R. Morris [ ]) using the primers Fw_Y2H_BARD1_SmaI (5’ TCCCCCGGGTATGCCGGATAATCGGCAGC) and Rv_BARD1_Notl (5’ ATAAGAATGCGGCCGCATCAGCTGTCAAGAGGAAGC) and cloned into the Sma I- Not I sites of the pGBKT7 bait vector (Takara Bio, Enzifarma, Porto, Portugal). pGADT7 AD-BRCA1, empty pGADT7 AD and pGADT7-T were transformed into Saccharomyces cerevisiae Y187 (Takara Bio, Enzifarma, Porto, Portugal) and selected in SD/-Leu plates. pGBKT7-BARD1 and pGBKT7-53 were transformed into S. cerevisiae Y2H Gold (Takara Bio, Enzifarma, Porto, Portugal) and selected in SD/-Leu plates.

Techniques: Western Blot, Immunofluorescence, Single Cell Gel Electrophoresis

Journal: Journal of Experimental & Clinical Cancer Research : CR

Article Title: A first-in-class inhibitor of homologous recombination DNA repair counteracts tumour growth, metastasis and therapeutic resistance in pancreatic cancer

doi: 10.1186/s13046-025-03389-5

Figure Lengend Snippet: BBIT20 does not induce cross-resistance in GEM-resistant MIA-PaCa-2 cells, inducing apoptosis, inhibiting P-glycoprotein drug efflux, and counteracting migration, invasion, EMT and GEM resistance. In ( A , B ), concentration-response curves for ( A ) GEM and ( B ) BBIT20, in non-resistant (parental) and GEM-resistant MIA-PaCa-2 cells, after 48 h of treatment. Growth obtained with control (DMSO) was set as 100%; data shown are mean ± SEM of four independent experiments (two replicates each); values of GEM-resistant cell growth significantly different from parental cells: **** p < 0.0001 (two-way ANOVA with Sidak’s test). In ( C ), effect of 3 and 6 µM of BBIT20 on apoptosis induction in GEM-resistant MIA-PaCa-2 cells, after 48 h of treatment; data are mean ± SEM of four independent experiments; values significantly different from DMSO: ** p < 0.01, **** p < 0.0001 (one-way ANOVA with Dunnett’s test). In ( D , E ), fluorescence intensity of P-gp activity in GEM-resistant MIA-PaCa-2 cells treated with DMSO (negative control), 100 µM of verapamil (positive control) and 6 µM of BBIT20, using the multidrug efflux transporter P-gp ligand screening kit, after 30 min of treatment. In ( D ), representative fluorescence images (scale bar = 50 μm; 400× magnification) of the intracellular accumulation of the fluorogenic P-gp substrate hydrolysis product, in GEM-resistant MIA-PaCa-2 cells treated with DMSO, 100 µM of verapamil (P-gp inhibitor) or 6 µM of BBIT20. In ( E ), mean of fluorescence intensity (Excitation/Emission = 488/532 nm) ± SEM of four independent experiments; values significantly different from DMSO or verapamil: *** p < 0.001, **** p < 0.0001 (one-way ANOVA with Tukey’s test). In ( F , G ), effect of 1.5 µM (IC 10 ) of BBIT20 on confluent GEM-resistant MIA-PaCa-2 cell migration after 6, 24, 30 and 48 h of treatment. In ( F ), representative images of the wound healing are shown (scale bar = 100 μm, 100× magnification). In ( G ), quantification of the wound closure determined considering randomly selected microscopic fields (four fields per sample), setting the initial wound area as 100%; data are mean ± SEM of four independent experiments; values significantly different from DMSO: ** p < 0.01 (two-way ANOVA with Sidak’s test). In ( H ), effect of 1.5 µM (IC 10 ) of BBIT20 on migration and invasion of GEM-resistant MIA-PaCa-2 cells, after 24 h of treatment. Migratory and invasive cells were quantified by fluorescence signal intensity; values obtained with DMSO were set as 1. Data are mean ± SEM of four independent experiments; values significantly different from DMSO: ** p < 0.01, *** p < 0.001 (unpaired student’s t -test). In ( I ), protein expression levels of E-cadherin, β-catenin, ZEB1 and MMP-9, after 48 h of treatment with 1.5 and 6 µM of BBIT20, in GEM-resistant MIA-PaCa-2 cells; representative immunoblots of four independent experiments are shown; GAPDH was used as a loading control. β-catenin and ZEB1 proteins used the same loading control. In ( J ), effect of 3 and 6 µM of BBIT20 on protein levels of ENT1 and RRM2 after 24 h of treatment, in GEM-resistant MIA-PaCa-2 cells. Representative immunoblots of four independent experiments are shown; GAPDH was used as a loading control. In ( K ), expression levels of miR-20a, after 24 h of treatment, in GEM-resistant MIA-PaCa-2 cells. Data are mean of fold induction relative to DMSO ± SEM of four independent experiments; values significantly different from DMSO: * p < 0.05 (one-way ANOVA with Dunnett’s test). In ( L ), putative molecular mechanisms for overcoming GEM resistance by BBIT20. (1) Disruption of the BRCA1-BARD1 interaction, leading to BRCA1 nuclear-cytoplasmic shuttling and degradation, resulting in increased DNA damage, genomic instability, and promotion of cell death; (2) Inhibition of the multidrug resistance P-glycoprotein activity, reducing GEM efflux, and enhancing intracellular GEM accumulation; (3) Upregulation of human equilibrative nucleoside transporters (hENT1), increasing GEM uptake; (4) Downregulation of GEM metabolism-related resistance enzymes, including ribonucleotide reductase 1 and 2 (RRM1/2) and thymidylate synthase (TS), which decreases the alternative nucleotide pool. RRM1 and RRM2 convert ribonucleotide diphosphates (CDP) to deoxyribonucleotide diphosphates (dCDP), that are further converted into deoxycytidine triphosphate (dCTP), the competitive inhibitor of GEM. TS increases the alternative nucleotide pool by converting deoxyuridylate (dUMP) to deoxythymidylate (dTMP)

Article Snippet: The full-length BARD1 gene was amplified by PCR from the plasmid pY3H-AdeI-BARD1 (kind gift from Joanna R. Morris [ ]) using the primers Fw_Y2H_BARD1_SmaI (5’ TCCCCCGGGTATGCCGGATAATCGGCAGC) and Rv_BARD1_Notl (5’ ATAAGAATGCGGCCGCATCAGCTGTCAAGAGGAAGC) and cloned into the Sma I- Not I sites of the pGBKT7 bait vector (Takara Bio, Enzifarma, Porto, Portugal). pGADT7 AD-BRCA1, empty pGADT7 AD and pGADT7-T were transformed into Saccharomyces cerevisiae Y187 (Takara Bio, Enzifarma, Porto, Portugal) and selected in SD/-Leu plates. pGBKT7-BARD1 and pGBKT7-53 were transformed into S. cerevisiae Y2H Gold (Takara Bio, Enzifarma, Porto, Portugal) and selected in SD/-Leu plates.

Techniques: Migration, Concentration Assay, Control, Fluorescence, Activity Assay, Negative Control, Positive Control, Expressing, Western Blot, Disruption, Inhibition

Journal: Journal of Experimental & Clinical Cancer Research : CR

Article Title: A first-in-class inhibitor of homologous recombination DNA repair counteracts tumour growth, metastasis and therapeutic resistance in pancreatic cancer

doi: 10.1186/s13046-025-03389-5

Figure Lengend Snippet: BBIT20 inhibits the growth of patient-derived organoids of PDAC, enhancing the cytotoxic effects of OLAP and GEM by inducing apoptosis. In ( A ), dose-response curves of BBIT20, OLAP and GEM in wtBRCA PDOs, determined by CellTiter-Glo ® assay, after 72 h of treatment. Data are mean ± SEM of three independent experiments. In ( B ), quantification of activated caspase-3/7-positive cells in organoid culture treated for 72 h with vehicle (DMSO) or IC 50 of BBIT20 (9.44 µM for PDO1, 8.63 µM for PDO2, and 7.07 µM for PDO3). Data are mean ± SEM of three independent experiments; values significantly different from DMSO: * p < 0.05, **** p < 0.0001 (two-way ANOVA with Sidak’s test). In ( C ), haematoxylin and eosin (H&E) and immunohistochemistry staining (Ki-67, BAX, BRCA1, RAD51, and γH2AX) of organoid cultures treated for 72 h with vehicle (DMSO) or IC 50 of BBIT20 (scale bar = 50 µm; 400× magnification). In ( D - H ), quantification of (D) Ki-67, ( E ) BAX staining by 3,3’-diaminobenzidine (DAB) intensity, ( F ) BRCA1, ( G ) RAD51, and ( H ) γH2AX, in PDOs. Data are mean ± SEM of three independent experiments; values significantly different from DMSO: * p < 0.05, ** p < 0.01, *** p < 0.001, **** p < 0.0001 (one-way ANOVA with Sidak’s test). In ( I , J ), viability effects in PDO1 ( I ) and PDO3 (J) treated with the IC 10 concentration of BBIT20 (6.78 µM for PDO1 and 4.5 µM for PDO3), OLAP or GEM alone, and BBIT20 (IC 10 ) plus OLAP or GEM, after 72 h of treatment. Drug combination studies were performed using CellTiter-Glo ® . Viability obtained with control (DMSO) was set as 100%; data are mean ± SEM of three independent experiments. Organoids viability significantly different from OLAP or GEM alone: ** p < 0.01, *** p < 0.001 (one-way ANOVA with Sidak’s test). In ( K ), activated caspase-3/7 staining (CellEvent™ Caspase-3/7 green detection), in PDO1 and PDO3 treated with vehicle (DMSO), IC 10 and IC 50 of BBIT20, OLAP or GEM alone, and BBIT20 (IC 10 ) plus OLAP or GEM, after 72 h of treatment. Representative images of caspase-3/7 staining (green), and nuclear Hoechst staining (blue), are shown; magnification = 400×, scale bar = 200 μm. In ( L , M ), quantification of activated caspase-3/7-positive cells in ( L ) PDO1 and ( M ) PDO3 treated with vehicle (DMSO), IC 10 of BBIT20, OLAP or GEM alone, after 72 h of treatment. Data are mean ± SEM of three independent experiments, values significantly different from OLAP or GEM: ** p < 0.01, *** p < 0.001 (one-way ANOVA with Sidak’s test)

Article Snippet: The full-length BARD1 gene was amplified by PCR from the plasmid pY3H-AdeI-BARD1 (kind gift from Joanna R. Morris [ ]) using the primers Fw_Y2H_BARD1_SmaI (5’ TCCCCCGGGTATGCCGGATAATCGGCAGC) and Rv_BARD1_Notl (5’ ATAAGAATGCGGCCGCATCAGCTGTCAAGAGGAAGC) and cloned into the Sma I- Not I sites of the pGBKT7 bait vector (Takara Bio, Enzifarma, Porto, Portugal). pGADT7 AD-BRCA1, empty pGADT7 AD and pGADT7-T were transformed into Saccharomyces cerevisiae Y187 (Takara Bio, Enzifarma, Porto, Portugal) and selected in SD/-Leu plates. pGBKT7-BARD1 and pGBKT7-53 were transformed into S. cerevisiae Y2H Gold (Takara Bio, Enzifarma, Porto, Portugal) and selected in SD/-Leu plates.

Techniques: Derivative Assay, Glo Assay, Immunohistochemistry, Staining, Concentration Assay, Control

Journal: Journal of Experimental & Clinical Cancer Research : CR

Article Title: A first-in-class inhibitor of homologous recombination DNA repair counteracts tumour growth, metastasis and therapeutic resistance in pancreatic cancer

doi: 10.1186/s13046-025-03389-5

Figure Lengend Snippet: BBIT20 improves overall survival, inhibits tumour growth and reduces liver metastasis in an orthotopic xenograft mouse model of PDAC. Rag2 −/− IL2rg −/− mice orthotopically inoculated into the pancreas with PANC-1 cells and treated (intraperitoneal injection) three times per week with vehicle (5% DMSO in corn oil) or BBIT20 (2 mg/kg). In ( A ), Kaplan–Meier survival curves of mice over time (days after the first treatment). Survival of BBIT20-treated mice compared to vehicle: p > 0.05 (log-rank (Mantel–Cox) test). In (B-D), effect of BBIT20 on tumour growth, evaluated by magnetic resonance imaging (MRI), after ( B ) 14, ( C ) 21, and ( D ) 29 days of the first treatment. Representative images of tumour volume shown for the three timepoints using the same animals of each experimental group over time. Tumour volume represented as mean ± SEM. Tumour growth of BBIT20-treated group significantly different from vehicle: * p < 0.05 (unpaired t -test). In ( E ), representative images of H&E, Masson’s trichrome, Picrosirius red, COL11A1, α-SMA, Ki-67, TUNEL, BRCA1, RAD51, Ku80, E-cadherin, MMP-9, survivin and PD-L1 staining (scale bar = 50 μm, 200× magnification) of vehicle and BBIT20-treated PDAC after 32 and 35 days of treatment, respectively. In ( F - Q ), quantification of ( F ) percentage area of tumour collagen density based on Masson’s trichrome and Picrosirius staining, ( G ) COL11A1 signal intensity, ( H ) α-SMA-positive cells and signal intensity, ( I ) Ki-67-positive cells, ( J ) TUNEL-positive cells, ( K ) BRCA1-positive cells, ( L ) RAD51-positive cells, ( M) Ku80-positive cells, ( N ) E-cadherin signal intensity, ( O ) MMP-9 signal intensity, ( P ) survivin-positive cells and signal intensity, and ( Q ) PD-L1 signal intensity, of four vehicle- and BBIT20-treated tumours. Values significantly different from vehicle: * p < 0.05, ** p < 0.01, *** p < 0.001, **** p < 0.0001 (unpaired t -test). In ( R - T ), effect of BBIT20 on liver macro-metastases. In ( R ), quantification of liver macro-metastasis on mice endpoint, represented as mean ± SEM, values not significantly different from vehicle: p > 0.05 (unpaired t -test). In ( S - T ), representative images of livers and macro-metastases of the same animals of each experimental group. In ( S ), livers with macro-metastasis observed by MRI on day 29 after the first treatment, and in ( T ) corresponding livers collected on mice endpoint (after 32 and 35 days of first treatment). In ( U ), representative H&E (scale bar = 50 μm, 200× magnification) and MUC1 immunohistochemical staining of vehicle and BBIT20-treated livers (upper images: scale bar = 5000 μm, 2.3× magnification; lower images: scale bar = 300 μm, 40× magnification), treated for 32 and 35 days, respectively, highlighting liver metastatic foci. In ( V ), quantification of liver MUC1-positive areas, underscoring the area of micro-metastasis of four vehicle- and BBIT20-treated livers. MUC1-positive area significantly different from vehicle: ** p < 0.01 (unpaired t -test)

Article Snippet: The full-length BARD1 gene was amplified by PCR from the plasmid pY3H-AdeI-BARD1 (kind gift from Joanna R. Morris [ ]) using the primers Fw_Y2H_BARD1_SmaI (5’ TCCCCCGGGTATGCCGGATAATCGGCAGC) and Rv_BARD1_Notl (5’ ATAAGAATGCGGCCGCATCAGCTGTCAAGAGGAAGC) and cloned into the Sma I- Not I sites of the pGBKT7 bait vector (Takara Bio, Enzifarma, Porto, Portugal). pGADT7 AD-BRCA1, empty pGADT7 AD and pGADT7-T were transformed into Saccharomyces cerevisiae Y187 (Takara Bio, Enzifarma, Porto, Portugal) and selected in SD/-Leu plates. pGBKT7-BARD1 and pGBKT7-53 were transformed into S. cerevisiae Y2H Gold (Takara Bio, Enzifarma, Porto, Portugal) and selected in SD/-Leu plates.

Techniques: Injection, Magnetic Resonance Imaging, TUNEL Assay, Staining, Immunohistochemical staining

Journal: Molecular cancer research : MCR

Article Title: BRCA1 Loss Induces GADD153-Mediated Doxorubicin Resistance in Prostate Cancer

doi: 10.1158/1541-7786.MCR-11-0155

Figure Lengend Snippet: BRCA1 increases doxorubicin sensitivity in prostate cancer. A, BRCA1 expression was determined by WB in human prostate cancer cell lines. B, PC3 (pcDNA3, pcDNA3 BRCA1, shRNA scramble, and shRNA BRCA1) and LNCaP (shRNA scramble and shRNA BRCA1) stable cell lines were generated and BRCA1 expression was determined by WB. C, cells were exposed to doxorubicin or etoposide and viability was determined by MTS. Each sample was assayed in triplicate in 2 biological independent experiments. D, cells were stained with Annexin V–FITC and PI and analyzed by FACS after doxorubicin treatment (2 μmol/L, 24 hours). The average from 3 biological independent experiments (bottom) or 1 representative experiment (top) is shown. E, cells were treated with doxorubicin, fixed, and stained with PI. DNA content was determined by FACS. Histogram shows the percentage of cells in G1, S, and G2/M phases. The figure depicts the result of 3 biological independent experiments. F, cells were exposed to doxorubicin and WB analysis was carried out by using anti-p21Waf1/Cip1, -lamin A/C, or -cyclin D1, E, A, and B1 antibodies. In the Western blots, the numbers under the bands indicate BRCA1 quantitation normalized to actin B and PC3 cells (A) or control (B, F).*, P < 0.05.

Article Snippet: BRCA1 expression vector (pcDNA3 BRCA1) has also been previously described ( 23 ). shRNA scramble control and shRNA BRCA1 were from Upstate. siRNA control and siRNA GADD153 were from Santa Cruz Biotechnology.

Techniques: Expressing, shRNA, Stable Transfection, Generated, Staining, Western Blot, Quantitation Assay, Control

Journal: Molecular cancer research : MCR

Article Title: BRCA1 Loss Induces GADD153-Mediated Doxorubicin Resistance in Prostate Cancer

doi: 10.1158/1541-7786.MCR-11-0155

Figure Lengend Snippet: BRCA1 protein binds several genes involved in cell-cycle and DNA damage response. BRCA1-ChIP was conducted from PC3 cells exposed to doxorubicin. DNA-ChIP was analyzed by qPCR by using primers located at the proximal promoter region of BLM, FEN1, DDB2, H3F3B, BRCA2, CCNB2, GADD153, and MAD2L1 genes or β-Globin as negative control. Fold enrichment was calculated normalizing data to input and GAL4 antibody. *, P < 0.05; **, P < 0.01.

Article Snippet: BRCA1 expression vector (pcDNA3 BRCA1) has also been previously described ( 23 ). shRNA scramble control and shRNA BRCA1 were from Upstate. siRNA control and siRNA GADD153 were from Santa Cruz Biotechnology.

Techniques: Negative Control

Journal: Molecular cancer research : MCR

Article Title: BRCA1 Loss Induces GADD153-Mediated Doxorubicin Resistance in Prostate Cancer

doi: 10.1158/1541-7786.MCR-11-0155

Figure Lengend Snippet: BRCA1 protein regulates several genes involved in cell-cycle and DNA damage response. pcDNA3 and pcDNA3 BRCA1 (A) or shRNA scramble and shRNA BRCA1 (B) stable cell lines were exposed to doxorubicin (1 μmol/L; 24 hours). mRNA expression levels for the indicated genes were analyzed by RT-qPCR. Data were normalized to actin B. Media and SD from 3 biological independent experiments are shown. *, P < 0.05; **, P < 0.01.

Article Snippet: BRCA1 expression vector (pcDNA3 BRCA1) has also been previously described ( 23 ). shRNA scramble control and shRNA BRCA1 were from Upstate. siRNA control and siRNA GADD153 were from Santa Cruz Biotechnology.

Techniques: shRNA, Stable Transfection, Expressing, Quantitative RT-PCR

Journal: Molecular cancer research : MCR

Article Title: BRCA1 Loss Induces GADD153-Mediated Doxorubicin Resistance in Prostate Cancer

doi: 10.1158/1541-7786.MCR-11-0155

Figure Lengend Snippet: BRCA1 induces several target genes expression in response to doxorubicin in prostate cancer xenografts. Nu/nu mice were inoculated with PC3 stable cells. Mice were injected i.p. with doxorubicin (8 mg doxorubicin/kg mouse) or vehicle (DMSO) on days 14 and 24. Mice were sacrificed 24 hours after the last injection and RT-qPCR analysis of candidate genes was carried out. Graph bar represents the average and SD from 5 tumors. Data were normalized to actin B. *, P < 0.05.

Article Snippet: BRCA1 expression vector (pcDNA3 BRCA1) has also been previously described ( 23 ). shRNA scramble control and shRNA BRCA1 were from Upstate. siRNA control and siRNA GADD153 were from Santa Cruz Biotechnology.

Techniques: Expressing, Injection, Quantitative RT-PCR

Journal: Molecular cancer research : MCR

Article Title: BRCA1 Loss Induces GADD153-Mediated Doxorubicin Resistance in Prostate Cancer

doi: 10.1158/1541-7786.MCR-11-0155

Figure Lengend Snippet: BRCA1 binds and regulates GADD153 promoter in prostate cancer cells. A, PC3 cells were exposed to different UV doses, incubated for 1 hour, and analyzed by WB by using anti-GADD153 and -actin antibodies. The numbers under the bands indicate GADD153 quantitation normalized to actin B and control. B, PC3 cells were exposed to different UV doses or doxorubicin and GADD153 mRNA expression levels were determined by RT-qPCR. Data were normalized to actin B (ACTB). One result from 3 biological independent experiments is shown. C, PC3 cells were transiently transfected with GADD153 luciferase plasmid, after 24 hours cells were treated as before, harvested, and luciferase activity was quantified. Data were normalized to total protein. All transfections were done in triplicate and each experiment was repeated 3 times. D, BRCA1-ChIP experiments were conducted from PC3 cells untreated or treated with doxorubicin as was described in Materials and Methods. qPCR was carried out with primers located at 1,900 or 200 bp upstream or 300 bp downstream from the TSS of the GADD153 gene. Fold enrichment was calculated normalizing data to input and IgG. E, binding assay was carried out from PC3 cells exposed or not to doxorubicin (1 μmol/L; 24 hours). F, PC3 stable cells were cotransfected with GADD153 luciferase plasmid and treated with doxorubicin (1 μmol/L; 24 hours) and harvested 48 hours posttransfection. Luciferase activity was measured. Transfections were done in triplicate in 3 biological independent experiments. *, P < 0.05; **, P < 0.01.

Article Snippet: BRCA1 expression vector (pcDNA3 BRCA1) has also been previously described ( 23 ). shRNA scramble control and shRNA BRCA1 were from Upstate. siRNA control and siRNA GADD153 were from Santa Cruz Biotechnology.

Techniques: Incubation, Quantitation Assay, Control, Expressing, Quantitative RT-PCR, Transfection, Luciferase, Plasmid Preparation, Activity Assay, Binding Assay

Journal: Molecular cancer research : MCR

Article Title: BRCA1 Loss Induces GADD153-Mediated Doxorubicin Resistance in Prostate Cancer

doi: 10.1158/1541-7786.MCR-11-0155

Figure Lengend Snippet: BRCA1 regulates doxorubicin-induced apoptosis and cell-cycle arrest through GADD153. A, PC3 cells were transfected with 50 pmol siRNA GADD153 and 72 hours posttransfection cells were harvest and GADD153 expression was determined by WB and RT-qPCR. The numbers under the bands indicate GADD153 quantitation normalized to actin B and control. B, PC3 stable cell lines (pcDNA3 or pcDNA3BRCA1) were transiently transfected with siRNA scramble or siRNA GADD153, exposed to doxorubicin (6 μmol/L) or vehicle (DMSO) during 24 hours, and double stained with Annexin-FITC and PI for FACS analysis. One representative experiment of 3 biological independent experiments is shown. C, alternatively, cells were exposed to doxorubicin (2 μmol/L; 24 hours) and then stained with PI for FACS analysis. Histogram shows the percentage of G1, S, and G2/M cells from 1 representative experiment from 3 biological independent experiments. *, P < 0.05.

Article Snippet: BRCA1 expression vector (pcDNA3 BRCA1) has also been previously described ( 23 ). shRNA scramble control and shRNA BRCA1 were from Upstate. siRNA control and siRNA GADD153 were from Santa Cruz Biotechnology.

Techniques: Transfection, Expressing, Quantitative RT-PCR, Quantitation Assay, Control, Stable Transfection, Staining

Journal: BioMed Research International

Article Title: Identification of Novel Breast Cancer Subtype-Specific Biomarkers by Integrating Genomics Analysis of DNA Copy Number Aberrations and miRNA-mRNA Dual Expression Profiling

doi: 10.1155/2015/746970

Figure Lengend Snippet: BRCA1 facilitates miR-143 and miR-145 processing. In order to confirm whether BRCA1 facilitates miR-143 and miR-145 processing, BRCA1 overexpression and siBRCA1 expression plasmids were transfected into MCF-7 cells. The empty vector or scramble siRNA expression vector served as controls. (a) BRCA1 mRNA level and (b) protein level were examined by qPCR and Western blot, respectively, in stable transfected cells, normalized by beta-actin ( ∗ P < 0.05 as compared with mock control; n = 3). Then, the expression levels of the primary (pri), precursor (pre), and mature (mat) forms of the indicated miRNAs were examined in human BRCA1 (c) overexpressed and (d) knock-down MCF-7 cells using qRT-PCR analysis. Pri- and pre-miRNAs were normalized by beta-actin, and mature miRNA was normalized by U6 snRNA ( ∗ P < 0.05 as compared with mock control; n = 3). Meanwhile, in vivo monitoring assay of pri-miRNA processing in (e) BRCA1 overexpression or (f) knock-down MCF-7 cells carrying miR-143 or miR-145 at the 3′ untranslated region of the luciferase gene. The intensities were normalized by Renilla luciferase and are shown as fold induction as compared with an empty pmirGLO vector ( ∗ P < 0.05; n = 3). Error bars represent standard deviation.

Article Snippet: MCF-7 cells were transfected with a pCMV6-XL4 vector containing the full-length BRCA1 gene purchased from Origene (Beijing, China) (empty vector as control) or pSilencer siRNA expression vector (Ambion) containing BRCA1 specific shRNA expression cassette (scramble shRNA expression vector as siRNA control).

Techniques: Over Expression, Expressing, Transfection, Plasmid Preparation, Western Blot, Quantitative RT-PCR, In Vivo, Luciferase, Standard Deviation

Journal: Oncotarget

Article Title: c-Jun N-terminal kinase 2 prevents luminal cell commitment in normal mammary glands and tumors by inhibiting p53/Notch1 and breast cancer gene 1 expression

doi:

Figure Lengend Snippet: A. p53ko tumors were measured until reaching 1.5 cm diameter ( n = 22 p53ko;jnk2wt , n = 18 p53ko;jnk2ko , Log rank test); B-C. p53ko tumors were immunostained and Ki-67 + and CK8/18 + cells were quantified ( n = 5); D-E. Expression of basal (red) and luminal (blue) markers was measured in p53ko tumors ( n = 8, E) and p53ko cell lines F. Western blot of BRCA1 expression in p53ko cells; G. p53ko cells were transfected with Brca1 promoter (BRCA1PR) or promoterless control (PRless) luciferase plasmids and assayed for promoter activity; H. Correlation of Brca1 expression and EMT-related gene expression was assessed in human tumors (UNC308, n = 308, and COMBINED855, n = 855) and p53ko mouse tumors ( n = 15, P.C. = Pearson Correlation). A nonparametric, two-tailed t -test was used to detect statistical differences between two groups. The Pearson's correlation was performed using data in H. * p < 0.05, ** p < 0.001, *** p < 0.0001.

Article Snippet: The BRCA1 expression plasmid (Dr. Elledge) obtained through Addgene [ ].

Techniques: Expressing, Western Blot, Transfection, Control, Luciferase, Activity Assay, Gene Expression, Two Tailed Test

Journal: Oncotarget

Article Title: c-Jun N-terminal kinase 2 prevents luminal cell commitment in normal mammary glands and tumors by inhibiting p53/Notch1 and breast cancer gene 1 expression

doi:

Figure Lengend Snippet: A. CD24/CD49f staining was compared in p53ko cell lines by flow cytometry; B. The percentage of CD24 − and CD24 + cells were assessed in p53ko;jnk2ko GFP-JNK2 cells that were gated for GFP expression (medium and high) by flow cytometry; C. CD24 + and CD24 − populations in p53ko;jnk2ko GFP-JNK2 cells were separated by FACS and expression of EMT/stem (red) and differentiation (blue) markers measured by qPCR; D. CD24 + and CD24 - populations in p53ko;jnk2ko GFP-JNK2 cells were tested for Gata-3 expression by RT-PCR; E. shJNK2 or GIPZ non-silencing plasmids were stably expressed in mutant p53-expressing MDA 231 and 21PT cell lines. JNK2 and SMA expression were measured by western blot; F. MDA 231 cells were assessed for EpCAM and CD44 expression; G. EpCAM hi and EpCAM neg/lo populations in MDA 231 cells were separated by FACS. Brca1 was measured by qPCR; H. Cell viability of p53ko cells was evaluated using MTT assay; I. p53ko cells were pulse labeled with BrdU. BrdU incorporation in CD24 + and CD24 − populations was measured; J. Western blot of ER and PR expression in p53ko cells; K. p53ko cells were cultured with charcoal stripped serum (CSS), CSS + Estradiol (E2), or CSS + E2 + Fulvestrant (F) and ER expression was measured by western blot; L. p53ko cells were cultured in full medium with or without F. Cell viability was measured at times indicated. Suppression of growth is shown as percentage of DMSO control growth for each genotype; M. Effect of E2 and E2-F treatment on orthotopically growing p53ko;jnk2ko GFP and GFP-JNK2 cells.

Article Snippet: The BRCA1 expression plasmid (Dr. Elledge) obtained through Addgene [ ].

Techniques: Staining, Flow Cytometry, Expressing, Reverse Transcription Polymerase Chain Reaction, Stable Transfection, Mutagenesis, Western Blot, MTT Assay, Labeling, BrdU Incorporation Assay, Cell Culture, Control

Journal: NPJ Genomic Medicine

Article Title: Functional assays provide a robust tool for the clinical annotation of genetic variants of uncertain significance

doi: 10.1038/npjgenmed.2016.1

Figure Lengend Snippet: BRCA1 variant mapping. ( a ) Overview of BRCA1 variants from amino acid residues 1396–1863. ( b ) Depiction of BRCA1 protein domains and motifs in the aa 1,315–1,863 region and the variants that have been tested by transcriptional assays in previous (blue) or the current (red) studies ( c ) Depiction of BRCA1 constructs used in this study and the locations of the variants tested. ( d ) VarCall analysis of missense variants in the carboxy-terminal region (aa 1,315–1,863 of the BRCA1 protein). Transcriptional assays were performed for 98 missense variants in the aa 1,395–1,864 context (9 of these represent retests), 10 missense variants were tested by transcriptional assays in the aa 1,315–1,863 context (3 variants found in the population, 7 variants not currently known to occur in the population). Transcriptional assays were performed using a luciferase reporter system where 293T cells were co-transfected with a reporter plasmid, pG5Luc, which contains a firefly luciferase gene under the control of five GAL4 binding sites, a pCDNA3 plasmid coding for either wild-type or variant BRCA1 constructs fused to the GAL4 DNA-binding domain, and an internal control containing a Renilla luciferase gene constitutively expressed (described in Carvalho et al. (2009)) . Results of these transcriptional assays were analysed using VarCall to predict the likelihood of pathogenicity. In addition, the coiled-coil domain and secondary structures of the BRCT domain were overlaid on the results. See for additional details.

Article Snippet: Fragments coding for the tandem BRCT domains of MCPH1 (aa 649–832) and MDC1 (aa 1,894–2,079) were obtained by PCR amplification ( ) and cloned into the pGBKT7 or pGADT7 vectors (Clontech) as fusions to the GAL4 DBD or AD, respectively. pGBKT7 BRCT, pGADT7 BRCT or empty pGBKT7 were transformed in the Y2HGold Saccharomyces cerevisiae strain and plated on dropout medium lacking Tryptophan (SD-Trp) or Leucine (-Leu) and number of colonies was scored.

Techniques: Variant Assay, Construct, Luciferase, Transfection, Plasmid Preparation, Binding Assay

Journal: NPJ Genomic Medicine

Article Title: Functional assays provide a robust tool for the clinical annotation of genetic variants of uncertain significance

doi: 10.1038/npjgenmed.2016.1

Figure Lengend Snippet: Mutagenesis screen to identify loss of function missense variants in MCPH1 and MDC1 tandem BRCT domains. ( a ) Expression in yeast of proteins containing the tandem BRCT of MCPH1 or MDC1 fused to the GAL4 DNA-binding domain (DBD), but not to the activation domain (AD) of GAL4, lead to growth inhibition and a small colony phenotype. Libraries of mutagenised constructs coding for the tandem BRCTs of MCPH1 or MDC1 were transformed into yeast and transformants with regular size colonies (carrying loss of function mutants) were isolated and sequenced to identify residues that disrupt the BRCT function. ( b ) Loss of function variants (red) cluster around the BRCT phosphopeptide-binding pocket in MCPH1 (PDB ID: 3U3Z) and MDC1 (PDB ID: 2AZM). ( c ) MCPH1 BRCT variants found in cancer samples and predicted to impair function, as inferred by BRCA1 data sets, (R693H and W815R) abrogate the small-colony phenotype, whereas a predicted neutral mutation (N661S) does not.

Article Snippet: Fragments coding for the tandem BRCT domains of MCPH1 (aa 649–832) and MDC1 (aa 1,894–2,079) were obtained by PCR amplification ( ) and cloned into the pGBKT7 or pGADT7 vectors (Clontech) as fusions to the GAL4 DBD or AD, respectively. pGBKT7 BRCT, pGADT7 BRCT or empty pGBKT7 were transformed in the Y2HGold Saccharomyces cerevisiae strain and plated on dropout medium lacking Tryptophan (SD-Trp) or Leucine (-Leu) and number of colonies was scored.

Techniques: Mutagenesis, Expressing, Binding Assay, Activation Assay, Inhibition, Construct, Transformation Assay, Isolation